84K杨PagMSBP1/2a基因对木质素合成的影响

doi:10.11707/j.1001-7488.20220606

Abstract

Abstract:

Objective: Membrane steroid-binding protein (MSBP) is a type of membrane-associated steroid receptor protein located on the cytoplasmic membrane, and it affects multiple processes of plant growth and development by initiating cell response to hormone regulatory signals, regulating steroid transport and metabolism. This study aims to study the role of MSBP during the poplar growth and development, especially its effect on wood formation, so as to provide a basis for the improvement of poplar wood quality. Method: AtMSBP1 protein sequence of Arabidopsis was used for homologous sequence alignment against the genome database of Populus trichocarpa and P. alba × P. glandulosa '84K' to obtain the nucleotide and amino acid sequences of poplar MSBP, and then aphylogenetic tree was constructed and the gene structure was analyzed. qPCR was used to analyze the tissue specific expression of MSBP genes in top buds, roots, stems and leaves of 84K poplar. The expression patterns of P. trichocarpa homologous genes in wood formation tissues were searched against the Aspwood database. The 35 S∷GFP-PagMSBP1/2a plant expression binary vector was constructed and transiently transformed into tobacco leaves by Agrobacterium. The subcellular localization of PagMSBP1/2a was observed by laser confocal microscope. 35 S∷PagMSBP1/2a plant expression binary vector was constructed and transformed into poplar 84K by Agrobacterium-mediated leaf disk method. The difference of xylem between PagMSBP1/2a-OE and control plants was investigated through cross-sections examined with microscopy. The content of lignin and the distribution of lignin in the vascular tissues of transgenic and control poplar stems were analyzed by acetyl bromide method and phloroglucinol staining respectively. Result: In this study, 7 poplar MSBP members were identified through homologous comparison, and the poplar genes were named according to evolutionary relationship and gene structure. Ameng them the homologous genes of AtMSBP1 and AtMSBP2 in poplar were named PtMSBP1/2a, PtMSBP1/2b and PtMSBP1/2c respectively, and PtMSBP1/2a had the most homology with AtMSBP1. The result of qPCR analysis showed that the three genes were all expressed in roots, stems, and leaves. The expression of PagMSBP1/2c in tissues was significantly lower than that of PagMSBP1/2a and PagMSBP1/2b, while the expression of PagMSBP1/2a was the highest in old stems, which was nearly 6 times higher than that in young stems. It is consistent with the high expression of PtMSBP1/2a in xylem during the process of wood formation as shown in the Aspwood data. The MSBP1/2a ortholog (PagMSBP1/2a) of 84K poplar was cloned and its encoded protein contained the trans-membrane domain at the N-end. The subcellular localization analysis showed that PagMSBP1/2a was localized in the endoplasmic reticulum membrane. The vector used for over-expression of PagMSBP1/2a was constructed and the gene was transformed into 84K poplar by Agrobacterium mediated leaf disk method. The transgenic poplars more grew slow and were shorter than the control. The lignin content in stems of PagMSBP1/2a overexpressed poplar was significantly lower than that of the control, and the soluble lignin content of acetylbromide decreased by 34.6%. Conclusion: PagMSBP1/2a is a steroid receptor protein located on the endoplasmic reticulum membrane, which is involved in regulating the lignin biosynthesis during the wood formation of poplar. Therefore, it can be used as a target gene in the poplar breeding for lignin content alteration.

Key words: PagMSBP1/2a, Populus alba × P. glandulosa '84K': subcellular location, overexpression, lignin,

CLC Number:

S718.46

Yajing Xu,Jiawei Wang,Yanqiu Zhao,Cheng Jiang,Lichao Huang,Yi An,Wei Zeng,Jin Zhang,Mengzhu Lu. Effect of PagMSBP1/2a Gene of 84K Poplar on Lignin Biosynthesis[J]. Scientia Silvae Sinicae, 2022, 58(6): 56-65.

Figures/Tables 7

Table 1

Fig.1

Fig.2

Fig.3

Fig.4

Fig.5

Fig.6

References 0

	李少锋. 林木木材形成机制及材性改良研究进展. 温带林业研究, 2019, 2 (2): 40- 47. doi: 10.3969/j.issn.2096-4900.2019.02.007
	Li S F . Wood formation mechanism and properties improvement in forest trees. Journal of Temperate Forestry Research, 2019, 2 (2): 40- 47. doi: 10.3969/j.issn.2096-4900.2019.02.007
	Bao H , Li E , Mansfield S D , et al. The developing xylem transcriptome and genome-wide analysis of alternative splicing in Populus trichocarpa (black cottonwood) populations. BMC Genomics, 2013, 14, 359. doi: 10.1186/1471-2164-14-359
	Barnes W , Anderson C . Acetyl bromide soluble lignin (ABSL) assay for total lignin quantification from plant biomass. Bio-protocol, 2017, 7 (5): e2149.
	Bassard J , Richert L , Geerinck J , et al. Protein-protein and protein-membrane associations in the lignin pathway. The Plant Cell, 2012, 24 (11): 4465- 4482. doi: 10.1105/tpc.112.102566
	Boerjan W , Ralph J , Baucher M . Lignin biosynthesis. Annual Review of Plant Biology, 2003, 54, 519- 546. doi: 10.1146/annurev.arplant.54.031902.134938
	Chaffey N , Barlow P , Sundberg B . Understanding the role of the cytoskeleton in wood formation in angiosperm trees: hybrid aspen (Populus tremula x P.tremuloides) as the model species. Tree Physiology, 2002, 22 (4): 239- 249. doi: 10.1093/treephys/22.4.239
	Chen H C , Li Q , Shuford C M , et al. Membrane protein complexes catalyze both 4- and 3-hydroxylation of cinnamic acid derivatives in monolignol biosynthesis. Proceedings of the National Academy of Sciences of the United States of America, 2011, 108 (52): 21253- 21258. doi: 10.1073/pnas.1116416109
	Falkenstein E , Meyer C , Eisen C , et al. Full-length cDNA sequence of a progesterone membrane-binding protein from porcine vascular smooth muscle cells. Biochemical and Biophysical Research Communications, 1996, 229 (1): 86- 89. doi: 10.1006/bbrc.1996.1761
	Foster C E , Martin T M , Pauly M . Comprehensive compositional analysis of plant cell walls (Lignocellulosic biomass) part I: lignin. Journal of Visualized Experiments, 2010, (37): 1745.
	Gou M , Ran X , Martin D W , et al. The scaffold proteins of lignin biosynthetic cytochrome P450 enzymes. Nature Plants, 2018, 4 (5): 299- 310. doi: 10.1038/s41477-018-0142-9
	Hu B , Jin J , Guo A , et al. GSDS 2.0: an upgraded gene feature visualization server. Bioinformatics, 2015, 31 (8): 1296- 1297. doi: 10.1093/bioinformatics/btu817
	Kao A L , Chang T Y , Chang S H , et al. Characterization of a novel Arabidopsis protein family AtMAPR homologous to 25-Dx/IZAg/Hpr6.6 proteins. Botanical Bulletin of Academia Sinica, 2005, 46, 107- 118.
	Kimura I , Nakayama Y , Konishi M , et al. Functions of MAPR (membrane-associated progesterone receptor) family members as heme/steroid-binding proteins. Current Protein and Peptide Science, 2012, 13 (7): 687- 696. doi: 10.2174/138920312804142110
	Kumar S , Stecher G , Tamura K . MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution, 2016, 33 (7): 1870- 1874. doi: 10.1093/molbev/msw054
	Mifsud W, Bateman A. 2002. Membrane-bound progesterone receptors contain a cytochrome b5-like ligand-binding domain. Genome Biology, 3(12): RESEARCH0068.
	Mitsuda N , Iwase A , Yamamoto H , et al. NAC Transcription Factors, NST1 and NST3, are key regulators of the formation of secondary walls in woody tissues of Arabidopsis. The Plant Cell, 2007, 19 (1): 270- 280. doi: 10.1105/tpc.106.047043
	Qiu D , Bai S , Ma J , et al. The genome of Populus alba x Populus tremula var.glandulosa clone 84K. DNA Research, 2019, 26 (5): 423- 431. doi: 10.1093/dnares/dsz020
	Reddy M S , Chen F , Shadle G , et al. Targeted down-regulation of cytochrome P450 enzymes for forage quality improvement in alfalfa (Medicago sativa L.). Proceedings of the National Academy of Sciences of the United States of America, 2005, 102 (46): 16573- 16578. doi: 10.1073/pnas.0505749102
	Ryu C S , Klein K , Zanger U M . Membrane associated progesterone receptors: promiscuous proteins with pleiotropic functions-focus on interactions with cytochromes P450. Frontiers in Pharmacology, 2017, 8, 159.
	Scott E E , Wolf C R , Otyepka M , et al. The role of protein-protein and protein-membrane interactions on P450 function. Drug Metabolism and Disposition, 2016, 44 (4): 576- 590. doi: 10.1124/dmd.115.068569
	Shi Q , Yang X , Song L , et al. Arabidopsis MSBP1 is activated by HY5 and HYH and is involved in photomorphogenesis and brassinosteroid sensitivity regulation. Molecular Plant, 2011, 4 (6): 1092- 1104. doi: 10.1093/mp/ssr049
	Shi R , Sun Y , Li Q , et al. Towards a systems approach for lignin biosynthesis in Populus trichocarpa: Transcript Abundance and Specificity of the Monolignol Biosynthetic Genes. Plant Cell Physiology, 2010, 51 (1): 144- 163. doi: 10.1093/pcp/pcp175
	Song L , Shi Q M , Yang X H , et al. Membrane steroid-binding protein 1 (MSBP1) negatively regulates brassinosteroid signaling by enhancing the endocytosis of BAK1. Cell Research, 2009, 19 (7): 864- 876. doi: 10.1038/cr.2009.66
	Stewart J J , Akiyama T , Chapple C , et al. The effects on lignin structure of overexpression of ferulate 5-hydroxylase in hybrid Poplar. Plant Physiology, 2009, 150 (2): 621- 635. doi: 10.1104/pp.109.137059
	Sundell D , Street N R , Kumar M , et al. AspWood: High-Spatial-Resolution transcriptome profiles reveal uncharacterized modularity of wood formation in Populus tremula. The Plant Cell, 2017, 29 (7): 1585- 1604. doi: 10.1105/tpc.17.00153
	Voelker S L , Lachenbruch B , Meinzer F C , et al. Antisense down-regulation of 4CL expression alters lignification, tree growth, and saccharification potential of field-grown poplar. Plant Physiology, 2010, 154 (2): 874- 886. doi: 10.1104/pp.110.159269
	Weng J-K , Li X , Bonawitz N D , et al. Emerging strategies of lignin engineering and degradation for cellulosic biofuel production. Current Opinion in Biotechnology, 2008, 19 (2): 166- 172. doi: 10.1016/j.copbio.2008.02.014
	Witzel K , Matros A , Møller A L B , et al. Plasma membrane proteome analysis identifies a role of barley membrane steroid binding protein in root architecture response to salinity. Plant, Cell & Environment, 2018, 41 (6): 1311- 1330.
	Yang X H , Xu Z H , Xue H W . Arabidopsis membrane steroid binding protein 1 is involved in inhibition of cell elongation. The Plant Cell, 2005, 17 (1): 116- 131. doi: 10.1105/tpc.104.028381
	Yang X , Song L , Xue H . Membrane Steroid Binding Protein 1 (MSBP1) stimulates tropism by regulating vesicle trafficking and auxin redistribution. Molecular Plant, 2008, 1 (6): 1077- 1087. doi: 10.1093/mp/ssn071
	Zeng W , Lampugnani E R , Picard K L , et al. Asparagus IRX9, IRX10, and IRX14A are components of an active xylan backbone synthase complex that forms in the Golgi apparatus. Plant Physiology, 2016, 171 (1): 93- 109. doi: 10.1104/pp.15.01919
	Zhang L , Liu B , Zhang J , et al. Insights of molecular mechanism of xylem development in five black poplar cultivars. Frontiers in Plant Science, 2020, 11, 620. doi: 10.3389/fpls.2020.00620
	Zhou H , Song X , Wei K , et al. Growth-regulating factor 15 is required for leaf size control in Populus. Tree Physiology, 2019, 39 (3): 381- 390. doi: 10.1093/treephys/tpy107

引物名称 Primer name	引物序列 Primer sequence (5′-3′)
PagMSBP1/2a-q-F	CAGAAAGTGATGCTTCCAAGC
PagMSBP1/2a-q-R	CTATTCCTCCTTGGATTCAGCGA
PagMSBP1/2b-q-F	GAACGATGTTGCTAAGCCAG
PagMSBP1/2b-q-R	ACTCTTCCTTGGATTCACCACC
PagMSBP1/2c-q-F PagMSBP1/2c-q-R PagMSBP1/2a-F	GCCGTTATGGTGGTGGTTT TTGTGGTTGTGGTTCTGGTG ATGGCTTTGGAACTATGGGA
PagMSBP1/2a-R	TTATTCCTCCTTGGATTCAGC
Actin-F	AAACTGTAATGGTCCTCCCTCCG
Actin-R gw-PagMSBP1/2a-F gw-PagMSBP1/2a-R	GCATCATCACAATCACTCTCCGA GGGGACAAGTTTGTACAAAAAAGCAGGCTCG ATGGCTTTGGAACTATGGGA GGGGACCACTTTGTACAAGAAAGCTGGGTC TTATTCCTCCTTGGATTCAGC

[1]	Jiazhou Shang,Tianhui Gao,Weifeng Wang,Xinjun Zhou,Yuzheng Zong. Effect of Nitrogen Addition for Two Consecutive Years on Photosynthetic Characteristics, Carbon and Nitrogen Distribution of Populus × euramericana 'Zhongjin7' Seedlings [J]. Scientia Silvae Sinicae, 2022, 58(6): 23-32.
[2]	Youcai Gui,Songlin Zuo,Kainan Jin. Preparation of High-Surface-Area Carbon Foam by Self-Bubbling Method of Lignin [J]. Scientia Silvae Sinicae, 2022, 58(3): 139-148.
[3]	Ru Jia,Haiyan Sun,Yurong Wang,Rui Wang,Rongjun Zhao,Haiqing Ren. Relativity of Microstructures and Mechanical Properties of Juvenile Woods of 10-Year-Old New Chinese Fir Clones 'Yang 020' and 'Yang 061' [J]. Scientia Silvae Sinicae, 2021, 57(5): 165-175.
[4]	Xuejiao He,Liwei Chu,Shuangshuang Wen,Mengzhu Lu,Fang Tang. Study on the Gravity Response and Vascular Structure of Monocotyledons with Maize As An Example [J]. Scientia Silvae Sinicae, 2021, 57(2): 93-102.
[5]	Sheng Yang,Gaiyun Li. Chemical Composition Heterogeneity of Catalpa bungeana Wood [J]. Scientia Silvae Sinicae, 2021, 57(1): 169-177.
[6]	Wenjuan Wu,Chunyang Zou,Lijing Huang,Yongcan Jin. Dissolution and Regeneration of Bamboo in LiCl/DMSO Solvent System [J]. Scientia Silvae Sinicae, 2020, 56(9): 201-206.
[7]	Yu Zhou,Yanming Han,Gaiyu Li,Fuxiang Chu. Effect of Enzymatic Hydrolysis Lignin Mass Concentration on the Structure of Lignin Nano Particles and Drug-Loading Behavior [J]. Scientia Silvae Sinicae, 2020, 56(3): 109-116.
[8]	Ruyi Sha,Shasha Zhang,Zhan Yu,Fuquan Zhao,Chenggang Cai,Zhuqian Xiao,Jianwei Mao. Advances in Pseudo-Lignin Deposition and Its Effects on Enzymatic Hydrolysis of Cellulose [J]. Scientia Silvae Sinicae, 2020, 56(3): 127-143.
[9]	Huijing Fu,Xia Hu,Songqing Wu,Rong Wang,Guanghong Liang,Shiguo Huang,Feiping Zhang. Culture Conditions and Lignin-Degrading Function of Serratia marcescens Living in the Larval Gut of Monochamus alternatus [J]. Scientia Silvae Sinicae, 2020, 56(2): 106-115.
[10]	Jiaqi Hu,Qi Qi,Xiangning Jiang,Ying Gai. Effect of Fusion Gene 4CL1-CCR of Populus tomentosa on Lignin Deposition in Tobacco [J]. Scientia Silvae Sinicae, 2020, 56(10): 63-69.
[11]	Zhao Qingquan, Chi Yujie, Zhang Jian, Feng Lianrong. Transcriptome Construction and Related Gene Expression Analysis of Lenzites gibbosa in Woody Environment [J]. Scientia Silvae Sinicae, 2019, 55(8): 95-105.
[12]	Xiong Fuquan, Wang Hang, Han Yanming, Chu Fuxiang, Wu Yiqiang. Progress of Preparation and Application of Lignin Micro/Nano-Spheres [J]. Scientia Silvae Sinicae, 2019, 55(8): 170-175.
[13]	Huang Caoxing, He Juan, Lai Chenhuan, Narron Robert, Chang Houmin, Yong Qiang. Structure Characteristics and Thermal Properties of Black Liquor Lignin and Enzymatic Hydrolysis Lignin from Moso Bamboo Pretreated by Kraft Pulping [J]. Scientia Silvae Sinicae, 2018, 54(3): 108-116.
[14]	Jin Kexia, Wang Kun, Cui Heshuai, Yang Shumin, Tian Genlin, Liu Xing, Ma Jianfeng. Application of Raman Spectroscopy to the Research on Lignin [J]. Scientia Silvae Sinicae, 2018, 54(3): 144-151.
[15]	Zhou Houjun, Wei Kaili, Jiang Cheng, Zhao Yanqiu, Song Xueqin, Lu Mengzhu. Negative Regulation of GRF1/2d on the Formation and Development of Adventitious Roots in Populus alba×P. glandulosa ‘84K’ [J]. Scientia Silvae Sinicae, 2017, 53(3): 33-39.

Effect of PagMSBP1/2a Gene of 84K Poplar on Lignin Biosynthesis

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 7

References 0

Related Articles 15

Recommended Articles

Metrics

Comments