Scientia Silvae Sinicae ›› 2020, Vol. 56 ›› Issue (10): 63-69.doi: 10.11707/j.1001-7488.20201007
Previous Articles Next Articles
Jiaqi Hu1,Qi Qi2,Xiangning Jiang1,Ying Gai1,*
Received:2019-11-06
Online:2020-10-25
Published:2020-11-26
Contact:
Ying Gai
CLC Number:
Jiaqi Hu,Qi Qi,Xiangning Jiang,Ying Gai. Effect of Fusion Gene 4CL1-CCR of Populus tomentosa on Lignin Deposition in Tobacco[J]. Scientia Silvae Sinicae, 2020, 56(10): 63-69.
Table 1
Primers of PCR"
| 引物名称 Primer name | 引物序列 Primer sequence (5′—3′) |
| Actin-antisense | GGTGTTATGGTTGGTATGGGTC |
| Actin-sense | CCTCTCTGAGCCAATGGTAAT |
| F5H-F | CAACAGACCAGCCAACATAGCCATAAGC |
| F5H-R | GTTGCATTCCAGGGCAAGACCTCCGAC |
| COMT-F | AGATGCTCCAACTTACCCCG |
| COMT-R | GCCTTGCGAATCCAGTAAAACC |
| C3H-F | GACGAGTGGTGCCAAACAAC |
| C3H-R | ATTGAGCACTCTGTCCCTGC |
| 4CL1-CCR-F | GTTTGGCCTTGGCCTGAAAG |
| 4CL1-CCR-R | AAAACCAGGTGCATGTGGGA |
| CAD-F | AGTGGGACACATGGGAGTGA |
| CAD-R | AAACAAAAGGATACAAAAGACGACA |
Table 2
Lignin monolignols composition of control and transgenic tobacco"
| 株系 Line | G型木质素单体 G-unit monolignol/ (μg·mg-1) | S型木质素单体 S-unit monolignol/(μg·mg-1) | G:S |
| WT | 10.51±0.01 | 9.94±0.03 | 1.06±0.04 |
| WT | 10.65±0.59 | 9.81±0.28 | 1.09±0.41 |
| WT | 10.51±0.03 | 9.95±0.29 | 1.06±0.18 |
| 4CL1-CCR 2 | 12.32±0.07* | 10.49±0.66* | 1.17±0.05 |
| 4CL1-CCR 5-2 | 14.34±0.52* | 11.10±0.36* | 1.29±0.27* |
| 4CL1-CCR 10-1 | 12.96±0.45* | 9.85±0.65 | 1.32±0.47* |
| 4CL1-CCR 16-1 | 13.03±0.03* | 9.03±0.09 | 1.17±0.04 |
| 4CL1-CCR 20-2 | 11.81±0.13* | 9.35±0.86 | 1.26±0.01* |
Fig.3
The transverse anatomical structure of stem of transgenic tobacco A, B, C: Phloroglucinol stain(Green line: Xylem width); D, E, F: Lignin autofluorescence (Red arrow: Cell corner; White arrow: Compound middle lamella); G, H, I: Measurements of some elements of stem. Significantly different values at P < 0.05 are represented by asterisk(*), and determined by ANOVA followed by Dunnett's post-hoc test; the same below. "
| 侯佳音. 2014.重组双功能酶4CL1-CCR和CCR-4CL1的酶学特性研究.北京:北京林业大学硕士学位论文. | |
| Hou J Y. 2014. Research on enzyme characteristics of bifunctional enzyme 4CL1-CCR and CCR-4CL1. Beijing: MS thesis of Beijing Forestry University.[in Chinese] | |
|
Baucher M . Lignin:genetic engineering and impact on pulping. Critical Reviews in Biochemistry and Molecular Biology, 2003. 38 (4): 305- 350.
doi: 10.1080/10409230391036757 |
|
|
Chao N , Liu S X , Liu B M , et al. Molecular cloning and functional analysis of nine cinnamyl alcohol dehydrogenase family members in Populus tomentosa. Planta, 2014. 240 (5): 1097- 1112.
doi: 10.1007/s00425-014-2128-9 |
|
|
Chen X , Wang H , Li X , et al. Molecular cloning and functional analysis of 4-coumarate:CoA ligase 4(4CL-like 1)from Fraxinus mandshurica and its role in abiotic stress tolerance and cell wall synthesis. BMC Plant Biol, 2019. 19 (1): 231.
doi: 10.1186/s12870-019-1812-0 |
|
| Fang R , Cheng X S , Lin W S . Preparation and application of dimer acid/lignin graft copolymer. Bioresources, 2011. 6 (3): 2874- 2884. | |
|
Justo L , Christian N , Patricio P G . Structure and thermal properties of maliated lignin-recycled polystyrene composites. Journal of the Chilean Chemical Society, 2013. 58 (4): 1937- 1940.
doi: 10.4067/S0717-97072013000400005 |
|
| Kajita S , Hishiyama S , Tomimura Y , et al. Structural characterization of modified lignin in transgenic tobacco plants in which the activity of 4-coumarate:coenzyme A ligase is depressed. Plant Physiology, 1997. (114): 871- 879. | |
| Lee D , Meyer K , Chapple C , et al. Antisense suppression of 4-coumarate:coenzyme A ligase activity in Arabidopsis leads to altered lignin subunit composition. Plant Cell, 1997. 9 (11): 1985- 1998. | |
|
Leple J C , Dauwe R , Morreel K , et al. Downregulation of cinnamoyl-coenzyme A reductase in poplar:multiple-level phenotyping reveals effects on cell wall polymer metabolism and structure. Plant Cell, 2007. 19 (11): 3669- 3691.
doi: 10.1105/tpc.107.054148 |
|
|
Liu S , Qi Q , Chao N , et al. Overexpression of artificially fused bifunctional enzyme 4CL1-CCR:a method for production of secreted 4-hydroxycinnamaldehydes in Escherichia coli. Microbial Cell Factories, 2015. 14 (1): 118.
doi: 10.1186/s12934-015-0309-2 |
|
|
MacMillan C P , Birke H , Chuah A , et al. Tissue and cell-specific transcriptomes in cotton reveal the subtleties of gene regulation underlying the diversity of plant secondary cell walls. BMC Genomics, 2017. 18 (1): 539.
doi: 10.1186/s12864-017-3902-4 |
|
|
Prashant S , Srilakshmi Sunita M , Pramod S , et al. Down-regulation of Leucaena leucocephala cinnamoyl CoA reductase (LlCCR) gene induces significant changes in phenotype, soluble phenolic pools and lignin in transgenic tobacco. Plant Cell Reports, 2011. 30 (12): 2215- 2231.
doi: 10.1007/s00299-011-1127-6 |
|
|
Qi Q , Hu J Q , Qu L , et al. Rapid, simplified microscale quantitative analysis of lignin H/G/S composition with GC-MS in glass ampules and glass capillaries. MethodsX, 2019. 6, 2592- 2600.
doi: 10.1016/j.mex.2019.11.005 |
|
|
Reddy M S S , Chen F , Shadle G , et al. Targeted down-regulation of cytochrome P450 enzymes for forage quality improvement in alfalfa (Medicago sativa L.). Proceedings of the National Academy of Sciences of the United States of America, 2005. 102, 16573- 16578.
doi: 10.1073/pnas.0505749102 |
|
|
Segmehl J S , Keplinger T , Krasnobaev A , et al. Facilitated delignification in CAD deficient transgenic poplar studied by confocal Raman spectroscopy imaging. Spectrochimica Acta Part A:Molecular and Biomolecular Spectroscopy, 2019. 206, 177- 184.
doi: 10.1016/j.saa.2018.07.080 |
|
|
Tamasloukht B , Wong Quai Lam M S , Martinez Y , et al. Characterization of a cinnamoyl-CoA reductase 1 (CCR1) mutant in maize:effects on lignification, fibre development, and global gene expression. J Exp Bot, 2011. 62 (11): 3837- 3848.
doi: 10.1093/jxb/err077 |
|
|
Terashima N , Fukushima K . Heterogeneity in formation of lignin-XI:An autoradiographic study of the heterogeneous formation and structure of pine lignin. Wood Science Technology, 1988. 22 (3): 259- 270.
doi: 10.1007/BF00386021 |
|
|
Tian X , Xie J , Zhao Y , et al. Sense-, antisense-and RNAi-4CL1 regulate soluble phenolic acids, cell wall components and growth in transgenic Populus tomentosa Carr. Plant Physiol Biochem, 2013. 65, 111- 119.
doi: 10.1016/j.plaphy.2013.01.010 |
|
|
Van der Rest B , Danoun S , Boudet A M , et al. Down-regulation of cinnamoyl-CoA reductase in tomato (Solanum lycopersicum L.) induces dramatic changes in soluble phenolic pools. J Exp Bot, 2006. 57 (6): 1399- 1411.
doi: 10.1093/jxb/erj120 |
|
|
Vance C P , Kirk T K , Sherwood R T . Lignification as a mechanism of disease resistance. Annual Review of Phytopathology, 1980. 18 (1): 259- 288.
doi: 10.1146/annurev.py.18.090180.001355 |
|
|
Voelker S L , Lachenbruch B , Meinzer F C , et al. Antisense down-regulation of 4CL expression alters lignification, tree growth, and saccharification potential of field-grown poplar. Plant Physiology, 2010. 154 (2): 874- 886.
doi: 10.1104/pp.110.159269 |
|
|
Voelker S L , Lachenbruch B , Meinzer F C , et al. Reduced wood stiffness and strength, and altered stem form, in young antisense 4CL transgenic poplars with reduced lignin contents. New Phytol, 2011. 189 (4): 1096- 1109.
doi: 10.1111/j.1469-8137.2010.03572.x |
|
|
Wagner A , Donaldson L , Kim H , et al. Suppression of 4-coumarate-CoA ligase in the coniferous gymnosperm Pinus radiata. Plant Physiol, 2009. 149 (1): 370- 383.
doi: 10.1104/pp.108.125765 |
|
|
Weng J K , Chapple C . The origin and evolution of lignin biosynthesis. New Phytologist, 2010. 187 (2): 273- 285.
doi: 10.1111/j.1469-8137.2010.03327.x |
|
|
Xu B , Escamilla-Trevino L L , Sathitsuksanoh N , et al. Silencing of 4-coumarate:coenzyme A ligase in switchgrass leads to reduced lignin content and improved fermentable sugar yields for biofuel production. New Phytol, 2011. 192 (3): 611- 625.
doi: 10.1111/j.1469-8137.2011.03830.x |
|
|
Zhang W , Wei R , Chen S , et al. Functional characterization of CCR in birch (Betula platyphylla×Betula pendula) through overexpression and suppression analysis. Physiology Plant, 2015. 154 (2): 283- 296.
doi: 10.1111/ppl.12306 |
| [1] | Wenjuan Wu,Chunyang Zou,Lijing Huang,Yongcan Jin. Dissolution and Regeneration of Bamboo in LiCl/DMSO Solvent System [J]. Scientia Silvae Sinicae, 2020, 56(9): 201-206. |
| [2] | Yu Zhou,Yanming Han,Gaiyu Li,Fuxiang Chu. Effect of Enzymatic Hydrolysis Lignin Mass Concentration on the Structure of Lignin Nano Particles and Drug-Loading Behavior [J]. Scientia Silvae Sinicae, 2020, 56(3): 109-116. |
| [3] | Ruyi Sha,Shasha Zhang,Zhan Yu,Fuquan Zhao,Chenggang Cai,Zhuqian Xiao,Jianwei Mao. Advances in Pseudo-Lignin Deposition and Its Effects on Enzymatic Hydrolysis of Cellulose [J]. Scientia Silvae Sinicae, 2020, 56(3): 127-143. |
| [4] | Huijing Fu,Xia Hu,Songqing Wu,Rong Wang,Guanghong Liang,Shiguo Huang,Feiping Zhang. Culture Conditions and Lignin-Degrading Function of Serratia marcescens Living in the Larval Gut of Monochamus alternatus [J]. Scientia Silvae Sinicae, 2020, 56(2): 106-115. |
| [5] | Zhao Qingquan, Chi Yujie, Zhang Jian, Feng Lianrong. Transcriptome Construction and Related Gene Expression Analysis of Lenzites gibbosa in Woody Environment [J]. Scientia Silvae Sinicae, 2019, 55(8): 95-105. |
| [6] | Xiong Fuquan, Wang Hang, Han Yanming, Chu Fuxiang, Wu Yiqiang. Progress of Preparation and Application of Lignin Micro/Nano-Spheres [J]. Scientia Silvae Sinicae, 2019, 55(8): 170-175. |
| [7] | Huang Caoxing, He Juan, Lai Chenhuan, Narron Robert, Chang Houmin, Yong Qiang. Structure Characteristics and Thermal Properties of Black Liquor Lignin and Enzymatic Hydrolysis Lignin from Moso Bamboo Pretreated by Kraft Pulping [J]. Scientia Silvae Sinicae, 2018, 54(3): 108-116. |
| [8] | Jin Kexia, Wang Kun, Cui Heshuai, Yang Shumin, Tian Genlin, Liu Xing, Ma Jianfeng. Application of Raman Spectroscopy to the Research on Lignin [J]. Scientia Silvae Sinicae, 2018, 54(3): 144-151. |
| [9] | Wang Fengjuan, Li Weiqing, Mu Zhimei, Wang Yanwen, Liu Qingxin, Gao Huiju. Enzymological Characteristics of Ligninolytic Enzyme from Paraconiothyrium variabile GHJ-4 [J]. Scientia Silvae Sinicae, 2017, 53(1): 94-100. |
| [10] | Xiong Fuquan, Han Yanming, Li Gaiyun, Qin Tefu, Wang Siqun, Chu Fuxiang. Research Status of Click Chemistry Used for Chemical Modification of Lignocellulose [J]. Scientia Silvae Sinicae, 2016, 52(3): 90-96. |
| [11] | Zi Xiaoxue, Cao Yu, Yan Shaopeng, Wang Qiuyu. Ligocellulolytic Enzyme Activities in Three White-Rot Fungi and Genetic Polymorphism of These Enzyme-Related Genes Using TRAP Marker [J]. Scientia Silvae Sinicae, 2015, 51(6): 111-118. |
| [12] | Liu Tong, Yang Wenfeng, Xiao Xianzhou, Wei Fang, Gao Honghua, Luo Shiqiao, Wu Ming, Qiu Jian. Cloning of HbMYB20 from Hevea brasiliensis and Its Regulation of Secondary Wall Development in Arabidopsis thaliana [J]. Scientia Silvae Sinicae, 2015, 51(4): 52-59. |
| [13] | Gu Zhenjun, Zhang Huaiyun, Zhang Dangquan, Xie Yaojian, He Hanjie, Chen Lili, Peng Kuan, Liu Guo, Yang Dan. Gene Cloning and Alternative Splicing of CCoAOMT Subfamily Genes from Eucalyptus camaldulensis [J]. Scientia Silvae Sinicae, 2014, 50(5): 62-69. |
| [14] | Yu Cun, Chi Yujie. Detection on Manganese Peroxidase Activity and Cloning of Cu-mnp1 of Cerena unicolor [J]. Scientia Silvae Sinicae, 2014, 50(3): 109-116. |
| [15] | Yin Liwei, Chi Yujie. Phylogenetic Analysis and Detection on the Major Ligninolytic Enzymes of Hericium erinaceum Strain CB 1 [J]. Scientia Silvae Sinicae, 2013, 49(6): 129-134. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||